CloningAction

A CloningAction describes the molecular biology operation used to produce a cloned construct. It is always nested inside a CloningSource, which connects an action to its input nodes.

CloningParadigm

Every action has a paradigm — one of 12 supported cloning methods:

type CloningParadigm =
  | 'restriction' | 'gibson' | 'infusion' | 'slic' | 'cpec'
  | 'golden-gate' | 'gateway' | 'cre-lox' | 'flp-frt'
  | 'crispr' | 'ligation' | 'pcr';

CloningAction Interface

import type { CloningAction } from '@molbiohive/hatchlings';

Field	Type	Required	Description
paradigm	CloningParadigm	yes	Cloning method
label	string	no	Display label (defaults to paradigm name)
enzymes	string[]	no	Restriction enzymes (restriction, golden-gate)
operation	CreLoxOperation	no	Cre-lox operation type
attSites	AttSite[]	no	Gateway att sites
guide	string	no	CRISPR sgRNA guide sequence (20nt)
pam	string	no	CRISPR PAM motif (e.g. 'NGG' for SpCas9)
primers	string[]	no	Primer names or sequences (PCR)
temperature	string	no	Reaction temperature (e.g. '50°C')
duration	string	no	Reaction duration (e.g. '60 min')
notes	string	no	Free-text notes

Paradigm-Specific Fields

Different paradigms use different subsets of fields:

Restriction / Ligation

Uses enzymes to specify which restriction enzymes cut the DNA:

const action: CloningAction = {
  paradigm: 'restriction',
  enzymes: ['EcoRI', 'BamHI'],
  notes: 'Double digest at 37°C for 1 hour',
};

Gibson / InFusion / SLIC / CPEC

Overlap-based assembly methods. Use temperature and duration:

const action: CloningAction = {
  paradigm: 'gibson',
  temperature: '50°C',
  duration: '60 min',
};

Golden Gate

Type IIS restriction enzyme assembly. Uses enzymes:

const action: CloningAction = {
  paradigm: 'golden-gate',
  enzymes: ['BsaI'],
  temperature: '37°C / 16°C cycling',
  duration: '5 hours',
};

Gateway

Site-specific recombination with att sites:

const action: CloningAction = {
  paradigm: 'gateway',
  attSites: [
    { name: 'attL1', position: 0 },
    { name: 'attL2', position: 1500 },
    { name: 'attR1', position: 0 },
    { name: 'attR2', position: 2800 },
  ],
};

Cre-lox

Cre recombinase with loxP sites. Uses operation:

type CreLoxOperation = 'excision' | 'inversion' | 'insertion' | 'translocation';

const action: CloningAction = {
  paradigm: 'cre-lox',
  operation: 'excision',
  notes: 'Remove floxed selection cassette',
};

CRISPR-Cas9

HDR-mediated editing. Uses guide and pam:

const action: CloningAction = {
  paradigm: 'crispr',
  guide: 'ATGCGATCGATCGATCGATC',
  pam: 'NGG',
  notes: 'SpCas9 HDR with donor template',
};

PCR

Amplification with primers:

const action: CloningAction = {
  paradigm: 'pcr',
  primers: ['GFP_fwd', 'GFP_rev'],
  temperature: '98°C',
  duration: '30 cycles',
};

CloningSource

CloningSource wraps an action with its inputs and optional byproducts:

import type { CloningSource } from '@molbiohive/hatchlings';

Field	Type	Required	Description
action	CloningAction	yes	The cloning operation
inputs	CloningSourceInput[]	yes	Input constructs (1 or more)
byproducts	CloningNode[]	no	Secondary outputs (e.g. Gateway byproduct)

CloningSourceInput

Each input references a CloningNode with an optional display label:

import type { CloningSourceInput } from '@molbiohive/hatchlings';

Field	Type	Required	Description
node	CloningNode	yes	The input construct
label	string	no	Role label (e.g. 'Vector', 'Insert', 'Donor')

AttSite

Gateway recombination site:

Field	Type	Required	Description
name	string	yes	Site name (e.g. 'attL1', 'attR1')
position	number	no	Position on the construct (bp)

Related

• CloningNode — the construct that contains a CloningAction via its source
• Cloning Tree — how actions compose into multi-step histories
• CloningStrategyViewer — visualizes a single action